Search results

Search for "targeting" in Full Text gives 232 result(s) in Beilstein Journal of Organic Chemistry. Showing first 200.

Synthesis of nanodiamond derivatives carrying amino functions and quantification by a modified Kaiser test

  • Gerald Jarre,
  • Steffen Heyer,
  • Elisabeth Memmel,
  • Thomas Meinhardt and
  • Anke Krueger

Beilstein J. Org. Chem. 2014, 10, 2729–2737, doi:10.3762/bjoc.10.288

Graphical Abstract
  • functional moiety is not prone to hydrolytic or enzymatic decay. Stable conjugation is an essential prerequisite for applications such as labelling or targeting. Here we report on the grafting of nitrogen-containing heterocyclic aromatic compounds using the Diels–Alder reaction of suitable starting materials
PDF
Album
Supp Info
Full Research Paper
Published 20 Nov 2014

Anomalous diffusion of Ibuprofen in cyclodextrin nanosponge hydrogels: an HRMAS NMR study

  • Monica Ferro,
  • Franca Castiglione,
  • Carlo Punta,
  • Lucio Melone,
  • Walter Panzeri,
  • Barbara Rossi,
  • Francesco Trotta and
  • Andrea Mele

Beilstein J. Org. Chem. 2014, 10, 2715–2723, doi:10.3762/bjoc.10.286

Graphical Abstract
  • data on API loaded in complex systems resembling the formulations actually used for drug delivery, targeting or controlled release. Finally, the important issue of how subdiffusive and superdiffusive regime can be related to the structure of the gel should be addressed. In principle, the subdiffusive
PDF
Album
Full Research Paper
Published 19 Nov 2014

Linear-g-hyperbranched and cyclodextrin-based amphiphilic block copolymer as a multifunctional nanocarrier

  • Yamei Zhao,
  • Wei Tian,
  • Guang Yang and
  • Xiaodong Fan

Beilstein J. Org. Chem. 2014, 10, 2696–2703, doi:10.3762/bjoc.10.284

Graphical Abstract
  • accumulation of drug in the target site [8]. For this reason, the nanocarriers are required to combine various properties or functions in one system. Recently, the concept of multifunctional nanocarriers that can simultaneously perform multiple functions, such as longevity, targeting, stimuli sensitivity, and
  • of targeting, prolonged blood circulation time, etc. Therefore, they have attracted much attention [6][15][16][17][18][19]. However, to develop an efficient DDS constructed from ABC micelles, it is essential to consider some important factors, such as high drug loading and controlled release. Many of
PDF
Album
Supp Info
Full Research Paper
Published 18 Nov 2014

A small azide-modified thiazole-based reporter molecule for fluorescence and mass spectrometric detection

  • Stefanie Wolfram,
  • Hendryk Würfel,
  • Stefanie H. Habenicht,
  • Christine Lembke,
  • Phillipp Richter,
  • Eckhard Birckner,
  • Rainer Beckert and
  • Georg Pohnert

Beilstein J. Org. Chem. 2014, 10, 2470–2479, doi:10.3762/bjoc.10.258

Graphical Abstract
  • . We show model experiments that demonstrate the suitability of the molecule in labeling small molecules and in ABPP investigations. Fluorescence and MS offer orthogonal opportunities for detection and make this reporter a universal tool for targeting molecules of different sizes and properties
PDF
Album
Supp Info
Full Research Paper
Published 23 Oct 2014

Expanding the scope of cyclopropene reporters for the detection of metabolically engineered glycoproteins by Diels–Alder reactions

  • Anne-Katrin Späte,
  • Verena F. Schart,
  • Julia Häfner,
  • Andrea Niederwieser,
  • Thomas U. Mayer and
  • Valentin Wittmann

Beilstein J. Org. Chem. 2014, 10, 2235–2242, doi:10.3762/bjoc.10.232

Graphical Abstract
  • significantly higher fluorescence staining of cell-surface glycoconjugates, Ac4GlcNCyoc (1) gave higher labeling efficiency with protein preparations containing also intracellular proteins, possibly by targeting O-GlcN-acylated proteins. Since O-GlcN-acylation of proteins is associated with numerous crucial
PDF
Album
Supp Info
Full Research Paper
Published 22 Sep 2014

Expeditive synthesis of trithiotriazine-cored glycoclusters and inhibition of Pseudomonas aeruginosa biofilm formation

  • Meriem Smadhi,
  • Sophie de Bentzmann,
  • Anne Imberty,
  • Marc Gingras,
  • Raoudha Abderrahim and
  • Peter G. Goekjian

Beilstein J. Org. Chem. 2014, 10, 1981–1990, doi:10.3762/bjoc.10.206

Graphical Abstract
  • particular due to the physical barrier created by surface-attached biofilms, thus limiting antibiotic penetration [4][5][6]. A challenging and useful task is therefore to develop novel strategies against PA colonies at this late stage of virulence. Among recent approaches, targeting biofilm formation or
PDF
Album
Supp Info
Full Research Paper
Published 25 Aug 2014

Structure/affinity studies in the bicyclo-DNA series: Synthesis and properties of oligonucleotides containing bcen-T and iso-tricyclo-T nucleosides

  • Branislav Dugovic,
  • Michael Wagner and
  • Christian J. Leumann

Beilstein J. Org. Chem. 2014, 10, 1840–1847, doi:10.3762/bjoc.10.194

Graphical Abstract
  • ; Introduction Antisense oligonucleotides (ASOs) can interfere with gene expression via various biological mechanisms, depending on the nature of the cellular RNA target [1]. First and foremost they can inhibit translation by targeting a mature mRNA in either its coding or non-coding part of the sequence by a
  • steric block or an RNase H dependent degradation mechanism. Furthermore, it has recently been shown that ASOs can alter RNA splicing when targeting exon/intron junctions or splice enhancer or silencer binding sites on pre-mRNAs, thus leading to alternative splicing [2][3], to exon skipping [4][5] or to
  • growing number of micro RNAs (miRNAs) that are involved in genetic and epigenetic regulation of gene expression. Their misregulation stays at the onset of various forms of cancer and other metabolic diseases, and targeting of such miRNAs with ASOs (antimirs or anatagomirs) has been shown in the recent
PDF
Album
Supp Info
Full Research Paper
Published 12 Aug 2014

Efficient routes toward the synthesis of the D-rhamno-trisaccharide related to the A-band polysaccharide of Pseudomonas aeruginosa

  • Aritra Chaudhury,
  • Sajal K. Maity and
  • Rina Ghosh

Beilstein J. Org. Chem. 2014, 10, 1488–1494, doi:10.3762/bjoc.10.153

Graphical Abstract
  • and O-6 positions but also sets up the model on which various deoxygenation protocols may be tried. The linkage pattern and stereochemistry at the glycosidic positions on the target dictate the presence of acyl protection on the O-2 position as shown in Scheme 1. We began our synthesis targeting two
PDF
Album
Supp Info
Full Research Paper
Published 01 Jul 2014

Carbohydrate PEGylation, an approach to improve pharmacological potency

  • M. Eugenia Giorgi,
  • Rosalía Agusti and
  • Rosa M. de Lederkremer

Beilstein J. Org. Chem. 2014, 10, 1433–1444, doi:10.3762/bjoc.10.147

Graphical Abstract
  • increase solubility [8], prolong the in vivo action [9] or for targeting drug delivery [10] has been described. The potent anti-inflammatory drug dexamethasone was coupled to a multifunctional PEG, prepared by a click reaction, for treatment of rheumatoid arthritis [11]. A heterobifunctional PEG has been
  • conjugated with both paclitaxel, a potent anticancer drug, and alendronate, a bone-targeting biphosphonate, in order to obtain strong bone tropism and fast drug release [12]. An enzymatic method using a microbial transglutaminase was described for PEGylation of human growth hormone [13]. Glycans have been
  • by the use of a [3 + 2] cycloaddition reaction of an alkyne-bearing PEG reagent and an azide-functionalized tyrosine residue genetically incorporated on human superoxide dismutase-1 [30]. GlycoPEGylation, targeting carbohydrate sites, was conceived to produce a more homogeneous product with lower
PDF
Album
Review
Published 25 Jun 2014

Glycosystems in nanotechnology: Gold glyconanoparticles as carrier for anti-HIV prodrugs

  • Fabrizio Chiodo,
  • Marco Marradi,
  • Javier Calvo,
  • Eloisa Yuste and
  • Soledad Penadés

Beilstein J. Org. Chem. 2014, 10, 1339–1346, doi:10.3762/bjoc.10.136

Graphical Abstract
  • application of gold nanoparticles as a DDS is an expanding field due to the inert properties of the gold core, their controlled fabrication, and multifunctionality [14]. This last property allows the design of particles simultaneously containing multiple chemotherapeutics and targeting moieties. Few studies
  • ]. Our methodology for preparing GNPs allows the construction of particles simultaneously containing carbohydrates, peptides and targeting molecules in a controled way [21]. The use of biocompatible gold glyconanoparticles as scaffolds for the antiviral drugs could bring some important benefits such as
PDF
Album
Supp Info
Full Research Paper
Published 12 Jun 2014

Human dendritic cell activation induced by a permannosylated dendron containing an antigenic GM3-lactone mimetic

  • Renato Ribeiro-Viana,
  • Elena Bonechi,
  • Javier Rojo,
  • Clara Ballerini,
  • Giuseppina Comito,
  • Barbara Richichi and
  • Cristina Nativi

Beilstein J. Org. Chem. 2014, 10, 1317–1324, doi:10.3762/bjoc.10.133

Graphical Abstract
  • residues of mannose for DC targeting and one residue of an immunogenic mimetic of a carbohydrate melanoma associated antigen. The immunological assays demonstrated that the glycodendron 5 is able to induce human immature DC activation in terms of a phenotype expression of co-stimulatory molecules
  • expression and MHCII. Furthermore, DCs activated by the glycodendron 5 stimulate T lymphocytes to proliferate in a mixed lymphocytes reaction (MLR). Keywords: cancer immunotherapy; DC-SIGN; DC targeting; glycodendron; GM3-lactone mimetic; multivalent glycosystems; multivalent interactions; Introduction
  • strategies is to arm DCs with tumor-specific antigens. This issue has successfully been achieved by either culturing ex vivo DCs [16][17] from bone marrow precursors or more recently by targeting in vivo DC receptors with specific mAbs conjugated to tumor antigens [18][19]. In both cases, the development of
PDF
Album
Full Research Paper
Published 10 Jun 2014

Synthesis, characterization and DNA interaction studies of new triptycene derivatives

  • Sourav Chakraborty,
  • Snehasish Mondal,
  • Rina Kumari,
  • Sourav Bhowmick,
  • Prolay Das and
  • Neeladri Das

Beilstein J. Org. Chem. 2014, 10, 1290–1298, doi:10.3762/bjoc.10.130

Graphical Abstract
  • functionalities) with DNA. According to a literature survey, many metal-free small molecules are known to modify structural organization of DNA through recognition, binding, cleavage or crosslinking and reportedly have widespread applications in biology [26]. Targeting of DNA by several DNA-damaging agents have
PDF
Album
Supp Info
Full Research Paper
Published 05 Jun 2014

Atherton–Todd reaction: mechanism, scope and applications

  • Stéphanie S. Le Corre,
  • Mathieu Berchel,
  • Hélène Couthon-Gourvès,
  • Jean-Pierre Haelters and
  • Paul-Alain Jaffrès

Beilstein J. Org. Chem. 2014, 10, 1166–1196, doi:10.3762/bjoc.10.117

Graphical Abstract
PDF
Album
Review
Published 21 May 2014

Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

  • Li Zhao,
  • Yuki Nakae,
  • Hongmei Qin,
  • Tadamasa Ito,
  • Takahide Kimura,
  • Hideto Kojima,
  • Lawrence Chan and
  • Naoki Komatsu

Beilstein J. Org. Chem. 2014, 10, 707–713, doi:10.3762/bjoc.10.64

Graphical Abstract
  • immobilize DNA, more functions such as enough dispersibility and targeting efficacy are required to use ND in vivo as a gene vector. Therefore, a more reliable and general process is desired to add sufficient functions for ND-based gene vectors. Herein a conjugation of ND-PG with basic polypeptides (Arg8
PDF
Album
Full Research Paper
Published 24 Mar 2014

Synthesis of (2S,3R)-3-amino-2-hydroxydecanoic acid and its enantiomer: a non-proteinogenic amino acid segment of the linear pentapeptide microginin

  • Rajendra S. Rohokale and
  • Dilip D. Dhavale

Beilstein J. Org. Chem. 2014, 10, 667–671, doi:10.3762/bjoc.10.59

Graphical Abstract
  • ]. While targeting the synthesis of 2a, the Wittig olefination of 3a with n-hexyltriphenylphosphonium bromide and t-BuOK gave olefin 4a as a diasteromeric mixture of Z and E-isomers in the ratio 9.5:0.5 as shown by 1H NMR of the crude product. The catalytic hydrogenation of alkene 4a with 10% Pd/C in
PDF
Album
Supp Info
Full Research Paper
Published 17 Mar 2014

New sesquiterpene hydroquinones from the Caribbean sponge Aka coralliphagum

  • Qun Göthel and
  • Matthias Köck

Beilstein J. Org. Chem. 2014, 10, 613–621, doi:10.3762/bjoc.10.52

Graphical Abstract
  • , targeting cell lines L929 mouse fibroblasts, KB-31 epidermoid carcinoma, MCF-7 breast cancer, and FS4-LTM conditional immortalization human fibroblasts, respectively. The FS4-LTM cell line was incubated for 24 hours with the tested substances. The other cell lines were incubated for 5 days with the tested
PDF
Album
Supp Info
Full Research Paper
Published 06 Mar 2014

Preparation of new alkyne-modified ansamitocins by mutasynthesis

  • Kirsten Harmrolfs,
  • Lena Mancuso,
  • Binia Drung,
  • Florenz Sasse and
  • Andreas Kirschning

Beilstein J. Org. Chem. 2014, 10, 535–543, doi:10.3762/bjoc.10.49

Graphical Abstract
  • introduce a thiol linker by Huisgen-type cycloaddition which can principally be utilized to create tumor targeting conjugates. In bioactivity tests, only those new ansamitocin derivatives showed strong antiproliferative activity that bear an ester side chain at C-3. Keywords: ansamitocins; antibiotics
  • /ansamitocin conjugates [28] (Scheme 2). Bromo-ansamitocin 6 was obtained by mutasynthesis and was synthetically modified to the complex folic acid/drug conjugate 7. The vitamin folic acid has become a promising ligand for selectively targeting the folate receptor (FR) in cancer tissues where the FR is known
  • antiproliferative activity of the “click” product 27c is remarkable as it demonstrates that substantial structural changes at C20 of the ansamitocins are tolerated and thus alkyne substituents open up diverse opportunities to diversify that position as reported including the introduction of tumor targeting ligands
PDF
Album
Supp Info
Full Research Paper
Published 03 Mar 2014

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

  • Wolfgang Hüttel,
  • Jonathan B. Spencer and
  • Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

Graphical Abstract
  • the S. cinnamonensis strain A519 [19] Redirect©-PCR-targeting technology was used according to the supplier's instructions [21][42]. The disruption cassettes were amplified from a HinDIII-EcoRI-fragment of pIJ773 with the following primers (5' to 3') monD: oD1for: CGGCCGCCACATTCCCCGACCTGGT
PDF
Album
Letter
Published 10 Feb 2014

Recent applications of the divinylcyclopropane–cycloheptadiene rearrangement in organic synthesis

  • Sebastian Krüger and
  • Tanja Gaich

Beilstein J. Org. Chem. 2014, 10, 163–193, doi:10.3762/bjoc.10.14

Graphical Abstract
  • . Gaich et al. [38][39] used the DVCPR in a biosynthetic investigation targeting the dimethylallyltryptophan synthase. In order to test the biosynthetic hypothesis of the mode of action of the 4-prenylation of indoles by Arigoni and Wenkert (starting from L-tryptophan and dimethylallyl pyrophosphate
PDF
Album
Review
Published 16 Jan 2014

Synthesis and biological activity of N-substituted-tetrahydro-γ-carbolines containing peptide residues

  • Nadezhda V. Sokolova,
  • Valentine G. Nenajdenko,
  • Vladimir B. Sokolov,
  • Daria V. Vinogradova,
  • Elena F. Shevtsova,
  • Ludmila G. Dubova and
  • Sergey O. Bachurin

Beilstein J. Org. Chem. 2014, 10, 155–162, doi:10.3762/bjoc.10.13

Graphical Abstract
  • view, mitochondria and the MPT process are very attractive targets for the search of new neuroprotective agents [4][5]. Several promising mitochondria-targeting neuroprotectors have been reported in the literature. Thus, the antihistaminic drug dimebon [6][7], which relates to tetrahydro-γ-carboline
  • derivatives, has been found to stabilize and improve mitochondrial functions in different in vivo and in vitro models [8][9] (Figure 1). Another promising class of neuroprotectors are cell-permeable mitochondria-targeting synthetic small peptides, for example, the SS (Szeto–Schiller) peptide antioxidants [10
PDF
Album
Supp Info
Full Research Paper
Published 15 Jan 2014

Studies toward bivalent κ opioids derived from salvinorin A: heteromethylation of the furan ring reduces affinity

  • Thomas A. Munro,
  • Wei Xu,
  • Douglas M. Ho,
  • Lee-Yuan Liu-Chen and
  • Bruce M. Cohen

Beilstein J. Org. Chem. 2013, 9, 2916–2924, doi:10.3762/bjoc.9.328

Graphical Abstract
  • ligands with a furanylmethyl substituent (Figure 3), we decided to use a short linker. As an alternative approach, bivalent ligands with much longer linkers can bind simultaneously to both protomers in a receptor dimer, allowing selective targeting of specific receptor oligomers [21]. We also sought to
PDF
Album
Supp Info
Full Research Paper
Published 20 Dec 2013

An overview of the synthetic routes to the best selling drugs containing 6-membered heterocycles

  • Marcus Baumann and
  • Ian R. Baxendale

Beilstein J. Org. Chem. 2013, 9, 2265–2319, doi:10.3762/bjoc.9.265

Graphical Abstract
PDF
Album
Review
Published 30 Oct 2013

AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds

  • Qiuping Ding,
  • Dan Wang,
  • Puying Luo,
  • Meiling Liu,
  • Shouzhi Pu and
  • Liyun Zhou

Beilstein J. Org. Chem. 2013, 9, 1949–1956, doi:10.3762/bjoc.9.231

Graphical Abstract
  • single operation, play an important role in atom-economical organic chemistry. A cascade reaction is the most efficient way for targeting fine chemicals, agrochemicals, pharmaceutical drugs, drug intermediates and ingredients by a one-pot reaction in environmentally and economically friendly synthetic
PDF
Album
Supp Info
Full Research Paper
Published 27 Sep 2013

Synthesis and antibacterial activity of monocyclic 3-carboxamide tetramic acids

  • Yong-Chul Jeong and
  • Mark G. Moloney

Beilstein J. Org. Chem. 2013, 9, 1899–1906, doi:10.3762/bjoc.9.224

Graphical Abstract
  • exhibit a dual targeting ability at RNAP and UPPS, while 3-acyl piperidine-2,4-dione 1h only targets UPPS [10]. Although tetramates are well-known as a core component in many natural products that continue to excite interest [11][12][13][14], we carried out a more detailed study of the synthesis
PDF
Album
Supp Info
Full Research Paper
Published 19 Sep 2013

Synthesis of mucin-type O-glycan probes as aminopropyl glycosides

  • David Benito-Alifonso,
  • Rachel A. Jones,
  • Anh-Tuan Tran,
  • Hannah Woodward,
  • Nichola Smith and
  • M. Carmen Galan

Beilstein J. Org. Chem. 2013, 9, 1867–1872, doi:10.3762/bjoc.9.218

Graphical Abstract
  • create a plethora of potential binding sites for commensal and pathogenic microbes, and are also ligands for the targeting of leucocytes to endothelial cells. Secreted mucins found in the intestinal mucus gel and the glycocalyx contain hundreds of different mucin type, O-linked oligosaccharides and
PDF
Album
Supp Info
Full Research Paper
Published 13 Sep 2013
Other Beilstein-Institut Open Science Activities